ID: 1103867714_1103867722

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1103867714 1103867722
Species Human (GRCh38) Human (GRCh38)
Location 12:124066311-124066333 12:124066359-124066381
Sequence CCTCACAATTTCTGCTGATCAGG GCTGCAGTCAAGTTGTTGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 155} {0: 1, 1: 4, 2: 22, 3: 114, 4: 470}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!