ID: 1103899833_1103899836

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1103899833 1103899836
Species Human (GRCh38) Human (GRCh38)
Location 12:124297656-124297678 12:124297684-124297706
Sequence CCCCTTTTCACTGTGCAGCTAAT ACCTGTGATTTTTTTTTTATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 190} {0: 1, 1: 1, 2: 11, 3: 137, 4: 1205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!