ID: 1103915100_1103915113

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1103915100 1103915113
Species Human (GRCh38) Human (GRCh38)
Location 12:124372136-124372158 12:124372183-124372205
Sequence CCCTCCTTCTTCTCTGCCTTGAG GGCCTCCGCGTCCTTGCCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 77, 4: 721} {0: 1, 1: 0, 2: 0, 3: 19, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!