ID: 1103921075_1103921086

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1103921075 1103921086
Species Human (GRCh38) Human (GRCh38)
Location 12:124399444-124399466 12:124399495-124399517
Sequence CCTCCAAGTACACCGCCACCAAG GCATAGGCTCTGTGGCCAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 126} {0: 1, 1: 0, 2: 0, 3: 19, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!