ID: 1103929583_1103929587

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1103929583 1103929587
Species Human (GRCh38) Human (GRCh38)
Location 12:124442641-124442663 12:124442672-124442694
Sequence CCATACAAAATTGACTTTGGGGT GGTACACTGCCTAGTACAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 157} {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!