ID: 1103930879_1103930885

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1103930879 1103930885
Species Human (GRCh38) Human (GRCh38)
Location 12:124450155-124450177 12:124450181-124450203
Sequence CCAGAGCACACCCGGACAAACCC CACACCCCAGAGATTGGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 97} {0: 1, 1: 0, 2: 1, 3: 6, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!