ID: 1103987489_1103987500

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1103987489 1103987500
Species Human (GRCh38) Human (GRCh38)
Location 12:124777743-124777765 12:124777778-124777800
Sequence CCGGAAGGCAGGGCCCCCAGGCC CCTGGGCACCTATAATCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 413} {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!