ID: 1104024746_1104024751

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1104024746 1104024751
Species Human (GRCh38) Human (GRCh38)
Location 12:125017656-125017678 12:125017682-125017704
Sequence CCCCATTCTAGATCTGCTGGCAC GCACATGTCCAGGAGTTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 241} {0: 1, 1: 0, 2: 0, 3: 16, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!