ID: 1104040519_1104040526

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1104040519 1104040526
Species Human (GRCh38) Human (GRCh38)
Location 12:125127215-125127237 12:125127248-125127270
Sequence CCTGAGGTGGGGGGTCTGAGCCA CAGAGTGAGCAGCAGGAAGGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 25, 4: 536} {0: 1, 1: 0, 2: 8, 3: 89, 4: 691}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!