ID: 1104053079_1104053085

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1104053079 1104053085
Species Human (GRCh38) Human (GRCh38)
Location 12:125209363-125209385 12:125209393-125209415
Sequence CCCAGCCTGGGACAGCAGACGCT GCAGCAGAGTGGCTGGTCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 153} {0: 1, 1: 0, 2: 1, 3: 37, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!