ID: 1104081315_1104081320

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1104081315 1104081320
Species Human (GRCh38) Human (GRCh38)
Location 12:125432760-125432782 12:125432775-125432797
Sequence CCCTTTGATGGGCCGGCCTTGGT GCCTTGGTGGAATCGGCATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 299} {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!