ID: 1104106504_1104106508

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1104106504 1104106508
Species Human (GRCh38) Human (GRCh38)
Location 12:125664959-125664981 12:125664987-125665009
Sequence CCAGGAATCACCTGATGTTGTCT CTGGTGATGAGAAGTGTGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 125} {0: 1, 1: 0, 2: 1, 3: 15, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!