ID: 1104377784_1104377789

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1104377784 1104377789
Species Human (GRCh38) Human (GRCh38)
Location 12:128280078-128280100 12:128280097-128280119
Sequence CCAAGATTCATGCTGCCTGCTAC CTACATACATGAAAATGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 132} {0: 1, 1: 0, 2: 0, 3: 10, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!