ID: 1104388532_1104388537

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1104388532 1104388537
Species Human (GRCh38) Human (GRCh38)
Location 12:128372066-128372088 12:128372118-128372140
Sequence CCATCCTCAGTCCAGGCAACCAC CTGCCATCTTGCCCCCATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 389} {0: 1, 1: 2, 2: 5, 3: 44, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!