ID: 1104478182_1104478186

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1104478182 1104478186
Species Human (GRCh38) Human (GRCh38)
Location 12:129087653-129087675 12:129087679-129087701
Sequence CCTCTGGAGGGAGGACAGGCCTA ACACCTTGATGTCGGCCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 36, 4: 275} {0: 1, 1: 0, 2: 6, 3: 34, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!