ID: 1104485537_1104485550

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1104485537 1104485550
Species Human (GRCh38) Human (GRCh38)
Location 12:129148749-129148771 12:129148788-129148810
Sequence CCCTCCTCCACAGCTGCATGCCA AGAGGCTTCCTGGCAGGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 413} {0: 1, 1: 1, 2: 9, 3: 33, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!