ID: 1104513047_1104513051

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1104513047 1104513051
Species Human (GRCh38) Human (GRCh38)
Location 12:129399034-129399056 12:129399058-129399080
Sequence CCATGGCAGGATGTGGAAGGGCA AGGAGCACACACATGGGACAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 32, 3: 118, 4: 471} {0: 1, 1: 0, 2: 1, 3: 28, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!