ID: 1104556102_1104556107

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1104556102 1104556107
Species Human (GRCh38) Human (GRCh38)
Location 12:129801041-129801063 12:129801065-129801087
Sequence CCCGCACCTGGCTCGGAGGGTCC GGCCCACAGAGTCTCCCTGATGG
Strand - +
Off-target summary {0: 760, 1: 1656, 2: 1623, 3: 1147, 4: 935} {0: 1, 1: 1, 2: 5, 3: 28, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!