ID: 1104556103_1104556107

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1104556103 1104556107
Species Human (GRCh38) Human (GRCh38)
Location 12:129801042-129801064 12:129801065-129801087
Sequence CCGCACCTGGCTCGGAGGGTCCT GGCCCACAGAGTCTCCCTGATGG
Strand - +
Off-target summary {0: 1030, 1: 1401, 2: 846, 3: 660, 4: 758} {0: 1, 1: 1, 2: 5, 3: 28, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!