ID: 1104560622_1104560632

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1104560622 1104560632
Species Human (GRCh38) Human (GRCh38)
Location 12:129840614-129840636 12:129840654-129840676
Sequence CCAGGGCGGGGGCTGCGCAGCCT CAGCAAGGAGGCTCCCAGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 299} {0: 1, 1: 0, 2: 1, 3: 30, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!