ID: 1104632019_1104632030

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1104632019 1104632030
Species Human (GRCh38) Human (GRCh38)
Location 12:130411323-130411345 12:130411375-130411397
Sequence CCAGTCTGTACACCAGGTGTGAC CCTCCAGTATGATGTGGAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 90} {0: 1, 1: 0, 2: 18, 3: 77, 4: 405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!