ID: 1104722789_1104722795

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1104722789 1104722795
Species Human (GRCh38) Human (GRCh38)
Location 12:131054712-131054734 12:131054745-131054767
Sequence CCGGTCACTGGTCTTGGATATCT GTCTCTGCCGGGTCTTGCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 152} {0: 1, 1: 0, 2: 1, 3: 11, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!