ID: 1104727380_1104727389

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1104727380 1104727389
Species Human (GRCh38) Human (GRCh38)
Location 12:131086322-131086344 12:131086364-131086386
Sequence CCTTCTCCCATCCTGGGAGACTT GCCCAGGAATGCAGCCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 278} {0: 1, 1: 0, 2: 1, 3: 36, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!