ID: 1104729063_1104729074

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1104729063 1104729074
Species Human (GRCh38) Human (GRCh38)
Location 12:131095025-131095047 12:131095064-131095086
Sequence CCCCTGTACCCTGTGGCCTGTGC CTGAGTGAGCCCTGGGAACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 286} {0: 1, 1: 0, 2: 0, 3: 35, 4: 343}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!