ID: 1104731953_1104731955

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1104731953 1104731955
Species Human (GRCh38) Human (GRCh38)
Location 12:131111753-131111775 12:131111803-131111825
Sequence CCAGAATTTTCATTTGGCTCTTT ATTCTGTGTTTGATGAGACAGGG
Strand - +
Off-target summary {0: 3, 1: 11, 2: 50, 3: 242, 4: 839} {0: 1, 1: 0, 2: 2, 3: 37, 4: 638}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!