ID: 1104835150_1104835161

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1104835150 1104835161
Species Human (GRCh38) Human (GRCh38)
Location 12:131785321-131785343 12:131785368-131785390
Sequence CCACTCCTGGCCCTCCAGGATGC ATCTGCAGAAGCACAGCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 463} {0: 1, 1: 0, 2: 5, 3: 46, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!