ID: 1104859212_1104859225

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1104859212 1104859225
Species Human (GRCh38) Human (GRCh38)
Location 12:131916041-131916063 12:131916069-131916091
Sequence CCAGCCCTCCCCAGCCGTCCCAC GCAGTCCTGCCGGAACCTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 77, 4: 850} {0: 1, 1: 0, 2: 0, 3: 16, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!