ID: 1104871428_1104871432

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1104871428 1104871432
Species Human (GRCh38) Human (GRCh38)
Location 12:132001085-132001107 12:132001135-132001157
Sequence CCCACCGTGTGTGGAGACGAGAG GAGATAAAAGAAAAGACAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 80} {0: 95, 1: 134, 2: 69, 3: 122, 4: 1087}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!