ID: 1104876127_1104876136

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1104876127 1104876136
Species Human (GRCh38) Human (GRCh38)
Location 12:132036078-132036100 12:132036125-132036147
Sequence CCAGGTTCACACGGAATGTCGTG GAGCATTGTGGAACACACCCAGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 3, 3: 7, 4: 30} {0: 1, 1: 0, 2: 3, 3: 14, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!