ID: 1104905280_1104905286

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1104905280 1104905286
Species Human (GRCh38) Human (GRCh38)
Location 12:132210135-132210157 12:132210154-132210176
Sequence CCTCCAGAGATGGGTGGGTCCCT CCCTGGGGCCCGTCGTCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 142} {0: 1, 1: 0, 2: 0, 3: 9, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!