ID: 1104911077_1104911087

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1104911077 1104911087
Species Human (GRCh38) Human (GRCh38)
Location 12:132241216-132241238 12:132241249-132241271
Sequence CCTTCCAGGGGCCCTCCCTATAC CACGCCACACCCCCTTCCCGGGG
Strand - +
Off-target summary {0: 5, 1: 37, 2: 11, 3: 17, 4: 150} {0: 28, 1: 9, 2: 10, 3: 24, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!