ID: 1104962683_1104962697

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1104962683 1104962697
Species Human (GRCh38) Human (GRCh38)
Location 12:132495682-132495704 12:132495719-132495741
Sequence CCTGTTCCTCCCACAGAGTCCCA GGCTGCTCCCTCCGGGGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 341} {0: 1, 1: 1, 2: 0, 3: 36, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!