ID: 1104983375_1104983383

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1104983375 1104983383
Species Human (GRCh38) Human (GRCh38)
Location 12:132583573-132583595 12:132583608-132583630
Sequence CCGCCGCGCTGCACAATGGGCTC CCGCCCGCCGCCGCCGCCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 55} {0: 1, 1: 1, 2: 19, 3: 132, 4: 916}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!