ID: 1104984307_1104984319

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1104984307 1104984319
Species Human (GRCh38) Human (GRCh38)
Location 12:132587926-132587948 12:132587960-132587982
Sequence CCCTCCTGGGAGCACTCTGTGAG CTGGGAGCACTCTGTGAGGAGGG
Strand - +
Off-target summary {0: 5, 1: 1, 2: 4, 3: 25, 4: 228} {0: 2, 1: 0, 2: 1, 3: 35, 4: 401}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!