ID: 1105013656_1105013662

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1105013656 1105013662
Species Human (GRCh38) Human (GRCh38)
Location 12:132773033-132773055 12:132773065-132773087
Sequence CCACACAATCAAATAAATAACAT CCTTCTGGGGCAGCGGCGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 612} {0: 1, 1: 0, 2: 0, 3: 16, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!