ID: 1105021375_1105021385

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1105021375 1105021385
Species Human (GRCh38) Human (GRCh38)
Location 12:132818799-132818821 12:132818847-132818869
Sequence CCACCCGTGAAGCAGAGACAGCC AGCCTGCTGGGTAAAGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 162} {0: 1, 1: 0, 2: 1, 3: 26, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!