ID: 1105031441_1105031453

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1105031441 1105031453
Species Human (GRCh38) Human (GRCh38)
Location 12:132887256-132887278 12:132887296-132887318
Sequence CCGCGCCCAGACGCAGGAGCCGT CGGCGACTGCTTGCCTTCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 101} {0: 1, 1: 0, 2: 0, 3: 7, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!