ID: 1105040274_1105040293

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1105040274 1105040293
Species Human (GRCh38) Human (GRCh38)
Location 12:132956020-132956042 12:132956061-132956083
Sequence CCACCCCCGCGCGCCCCCAGAGC TTCCGCGCATGCGCCCAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 61, 4: 555} {0: 1, 1: 0, 2: 2, 3: 7, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!