ID: 1105063563_1105063568

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1105063563 1105063568
Species Human (GRCh38) Human (GRCh38)
Location 12:133176737-133176759 12:133176788-133176810
Sequence CCCTGAACAGACCAATAATAAGG TCCCCCACCAAAAAAGCCTAGGG
Strand - +
Off-target summary {0: 2, 1: 50, 2: 772, 3: 2659, 4: 3465} {0: 1, 1: 0, 2: 0, 3: 26, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!