ID: 1105065457_1105065466

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1105065457 1105065466
Species Human (GRCh38) Human (GRCh38)
Location 12:133193511-133193533 12:133193550-133193572
Sequence CCTTGTTGCTGCATCCTCTGGAG GACAGAAAGAGGGGCAAAAAAGG
Strand - +
Off-target summary {0: 20, 1: 59, 2: 144, 3: 207, 4: 469} {0: 1, 1: 0, 2: 8, 3: 67, 4: 842}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!