|
Left Crispr |
Right Crispr |
Crispr ID |
1105164003 |
1105164005 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:17480363-17480385
|
13:17480395-17480417
|
Sequence |
CCTCTCTTTTGAAGCAGCAGTTT |
CGTTTTGTAGAAACTGTAAGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 4, 1: 248, 2: 360, 3: 10349, 4: 22372} |
{0: 1, 1: 400, 2: 6473, 3: 22420, 4: 69552} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|