ID: 1105164003_1105164005

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1105164003 1105164005
Species Human (GRCh38) Human (GRCh38)
Location 13:17480363-17480385 13:17480395-17480417
Sequence CCTCTCTTTTGAAGCAGCAGTTT CGTTTTGTAGAAACTGTAAGTGG
Strand - +
Off-target summary {0: 4, 1: 248, 2: 360, 3: 10349, 4: 22372} {0: 1, 1: 400, 2: 6473, 3: 22420, 4: 69552}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!