ID: 1105188652_1105188656

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1105188652 1105188656
Species Human (GRCh38) Human (GRCh38)
Location 13:17865178-17865200 13:17865218-17865240
Sequence CCTCTCTTTTGAAGCAGCAGTTT GGAAACTGTAAGTGGATATTTGG
Strand - +
Off-target summary {0: 4, 1: 248, 2: 360, 3: 10349, 4: 22372} {0: 4, 1: 486, 2: 18725, 3: 32108, 4: 50803}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!