ID: 1105201000_1105201003

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1105201000 1105201003
Species Human (GRCh38) Human (GRCh38)
Location 13:18177613-18177635 13:18177632-18177654
Sequence CCATTGACCATCCTTTTACTGTC TGTCTTCTTCTAGTAAAAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 287} {0: 3, 1: 2, 2: 1, 3: 27, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!