ID: 1105212219_1105212222

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1105212219 1105212222
Species Human (GRCh38) Human (GRCh38)
Location 13:18263674-18263696 13:18263725-18263747
Sequence CCTTCCACCTTGTGGTTAGACAG TTGTTTGTTTGTTTTTGAGATGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 0, 3: 11, 4: 176} {0: 2013, 1: 1569, 2: 3104, 3: 101837, 4: 84700}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!