ID: 1105214916_1105214919

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1105214916 1105214919
Species Human (GRCh38) Human (GRCh38)
Location 13:18278393-18278415 13:18278415-18278437
Sequence CCACACATGGTCTGCAGCCTGCC CAGAATTGTCACTCTTAGCAAGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 4, 3: 22, 4: 275} {0: 2, 1: 2, 2: 2, 3: 14, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!