|
Left Crispr |
Right Crispr |
Crispr ID |
1105259864 |
1105259869 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:18771012-18771034
|
13:18771037-18771059
|
Sequence |
CCAAGCTGTACCTGTGCATCTTT |
GTCATGGCTGGAGCTGGAGCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 35, 1: 30, 2: 4, 3: 96, 4: 603} |
{0: 7, 1: 19, 2: 24, 3: 85, 4: 586} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|