ID: 1105263518_1105263526

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1105263518 1105263526
Species Human (GRCh38) Human (GRCh38)
Location 13:18797170-18797192 13:18797207-18797229
Sequence CCCTATACTCTCCTTCTGTACTG TACCATGAGGCTCTGCCTCTTGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 18, 3: 33, 4: 256} {0: 12, 1: 41, 2: 9, 3: 27, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!