ID: 1105265228_1105265236

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1105265228 1105265236
Species Human (GRCh38) Human (GRCh38)
Location 13:18809212-18809234 13:18809244-18809266
Sequence CCCTGATGGGGTTGTCCTGGGTG GTGATGAGAAAAATGCAGAATGG
Strand - +
Off-target summary {0: 6, 1: 7, 2: 5, 3: 15, 4: 183} {0: 4, 1: 0, 2: 5, 3: 45, 4: 497}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!