ID: 1105326773_1105326776

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1105326773 1105326776
Species Human (GRCh38) Human (GRCh38)
Location 13:19377485-19377507 13:19377514-19377536
Sequence CCTATGTGAGTTGGTAAATGTTT AAATACCTACGTATTTCCCTAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 22, 4: 260} {0: 1, 1: 1, 2: 0, 3: 17, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!