ID: 1105383671_1105383682

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1105383671 1105383682
Species Human (GRCh38) Human (GRCh38)
Location 13:19910766-19910788 13:19910811-19910833
Sequence CCTAAATACAATGAGAATAGTTG GGTGGATGTGGTTACTGTAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 326} {0: 2, 1: 3, 2: 16, 3: 49, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!